Review



agei ecori site  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc agei ecori site
    Agei Ecori Site, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 705 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agei+ecori+site/Tet-pLKO-puro+(Plasmid+%2321915)/bio_rxiv__64898__2026__03__31__715305-202-14-19
    Average 96 stars, based on 705 article reviews
    agei ecori site - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Control:

    Article Title: m 1 A in CAG repeat RNA binds to TDP-43 and induces neurodegeneration.
    Article Snippet: The cells were confirmed to be free of mycoplasma contamination by using LookOut Mycoplasma PCR Detection Kit (MP0035, Sigma-Aldrich). shRNAs against TRMT61A, TRMT61B and TRMT10C were designed and their sequences are listed in Supplementary Table 3. .. All shRNAs and control non-targeting shRNAs were cloned into the AgeI/EcoRI site of the pLKO.1 vector (Addgene, plasmid #10878) and confirmed by Sanger sequencing. .. Cells were transfected with pLKO.1/puro-shRNAs together with pLTR-G (Addgene plasmid #17532) envelope plasmid and pCMV-dR8.2 dvpr (Addgene plasmid #8455) package plasmid using PolyFect transfection reagent (QIAGEN).

    Clone Assay:

    Article Title: m 1 A in CAG repeat RNA binds to TDP-43 and induces neurodegeneration.
    Article Snippet: The cells were confirmed to be free of mycoplasma contamination by using LookOut Mycoplasma PCR Detection Kit (MP0035, Sigma-Aldrich). shRNAs against TRMT61A, TRMT61B and TRMT10C were designed and their sequences are listed in Supplementary Table 3. .. All shRNAs and control non-targeting shRNAs were cloned into the AgeI/EcoRI site of the pLKO.1 vector (Addgene, plasmid #10878) and confirmed by Sanger sequencing. .. Cells were transfected with pLKO.1/puro-shRNAs together with pLTR-G (Addgene plasmid #17532) envelope plasmid and pCMV-dR8.2 dvpr (Addgene plasmid #8455) package plasmid using PolyFect transfection reagent (QIAGEN).

    Article Title: Human PARPs modify RNA nucleobases in vitro and in cells
    Article Snippet: .. To make inducible TARG1 knock-down cells, TARG1 shRNA oligos were annealed and cloned into AgeI-EcoRI site of Tet-plko-Puro plasmid (Addgene 21915). ..

    Article Title: Attenuated CSF‐1R signalling drives cerebrovascular pathology
    Article Snippet: DNA from the above amplification was purified using a QIAquick PCR purification kit (Qiagen) and subjected to direct sequencing using the forward primer (above). .. For in vitro work, Native, and ΔA781_N783 CSF‐1R cDNA sequences were synthesised using GeneArt (Thermo Fisher Scientific) and cloned into the AgeI/EcoRI site of the pcDNA3‐EGFP expression plasmid (Addgene). .. The P824R expression construct was generated from the native CSF‐1R expression plasmid using the Q5® Site‐Directed Mutagenesis Kit (New England Biolabs) and the following primers: forward 5′‐TGGATGGCCCGAGAGAGCATCTTTG‐3′ and reverse 5′‐CTTCACAGGCAGGCGGGC‐3′.

    Plasmid Preparation:

    Article Title: m 1 A in CAG repeat RNA binds to TDP-43 and induces neurodegeneration.
    Article Snippet: The cells were confirmed to be free of mycoplasma contamination by using LookOut Mycoplasma PCR Detection Kit (MP0035, Sigma-Aldrich). shRNAs against TRMT61A, TRMT61B and TRMT10C were designed and their sequences are listed in Supplementary Table 3. .. All shRNAs and control non-targeting shRNAs were cloned into the AgeI/EcoRI site of the pLKO.1 vector (Addgene, plasmid #10878) and confirmed by Sanger sequencing. .. Cells were transfected with pLKO.1/puro-shRNAs together with pLTR-G (Addgene plasmid #17532) envelope plasmid and pCMV-dR8.2 dvpr (Addgene plasmid #8455) package plasmid using PolyFect transfection reagent (QIAGEN).

    Article Title: INHAT subunit SET/TAF-Iβ regulates PRC1-independent H2AK119 mono-ubiquitination via E3 ligase MIB1 in colon cancer
    Article Snippet: .. The oligonucleotides containing target sequences were annealed and inserted into the AgeI/EcoRI site of the pLKO.1-TRC plasmid (#10878, Addgene, Watertown, MA, USA). .. Co-transfection of the cloned pLKO.1-TRC vector with VSV-G envelope expressing plasmid pMD2.G (#12259, Addgene) and lentiviral packaging plasmid psPAX2 (#12260, Addgene) into HEK293T cells was performed.

    Article Title: Human PARPs modify RNA nucleobases in vitro and in cells
    Article Snippet: .. To make inducible TARG1 knock-down cells, TARG1 shRNA oligos were annealed and cloned into AgeI-EcoRI site of Tet-plko-Puro plasmid (Addgene 21915). ..

    Article Title: Viral integration drives multifocal HCC during the occult HBV infection
    Article Snippet: .. 8. shRNA oligos The EXT1 shRNA oligonucleotides were annealed and inserted into the AgeI / EcoRI site of the small hairpin RNA (shRNA) expression vector Tet-pLKO-puro (Addgene plasmid 21915). .. Scramble shRNA was used as a negative control. shRNA oligo sequences from Sigma as follows: Sequence 1: CCGGCAATTGTGAGGACATTCTCATCTCGAGATGAGAATGTCCTCACAATTGTTTTTG; Sequence 2: CCGGCCCAACTTTGATGTTTCTATTCTCGAGAATAGAAACATCAAAGTTGGGTTTTTG; Sequence 3: CCGGCCTTCGTTCCTTGGGATCAATCTCGAGATTGATCCCAAGGAACGAAGGTTTTTG 9.

    Article Title: INHAT subunit SET/TAF-Iβ regulates PRC1-independent H2AK119 mono-ubiquitination via E3 ligase MIB1 in colon cancer.
    Article Snippet: .. The oligonucleotides containing target sequences were annealed and inserted into the AgeI / EcoRI site of the pLKO.1-TRC plasmid (#10878, Addgene, Watertown, MA, USA). .. Co-transfection of the cloned pLKO.1-TRC vector with VSV-G envelope expressing plasmid pMD2.G (#12259, Addgene) and lentiviral packaging plasmid psPAX2 (#12260, Addgene) into HEK293T cells was performed.

    Article Title: Attenuated CSF‐1R signalling drives cerebrovascular pathology
    Article Snippet: DNA from the above amplification was purified using a QIAquick PCR purification kit (Qiagen) and subjected to direct sequencing using the forward primer (above). .. For in vitro work, Native, and ΔA781_N783 CSF‐1R cDNA sequences were synthesised using GeneArt (Thermo Fisher Scientific) and cloned into the AgeI/EcoRI site of the pcDNA3‐EGFP expression plasmid (Addgene). .. The P824R expression construct was generated from the native CSF‐1R expression plasmid using the Q5® Site‐Directed Mutagenesis Kit (New England Biolabs) and the following primers: forward 5′‐TGGATGGCCCGAGAGAGCATCTTTG‐3′ and reverse 5′‐CTTCACAGGCAGGCGGGC‐3′.

    Sequencing:

    Article Title: m 1 A in CAG repeat RNA binds to TDP-43 and induces neurodegeneration.
    Article Snippet: The cells were confirmed to be free of mycoplasma contamination by using LookOut Mycoplasma PCR Detection Kit (MP0035, Sigma-Aldrich). shRNAs against TRMT61A, TRMT61B and TRMT10C were designed and their sequences are listed in Supplementary Table 3. .. All shRNAs and control non-targeting shRNAs were cloned into the AgeI/EcoRI site of the pLKO.1 vector (Addgene, plasmid #10878) and confirmed by Sanger sequencing. .. Cells were transfected with pLKO.1/puro-shRNAs together with pLTR-G (Addgene plasmid #17532) envelope plasmid and pCMV-dR8.2 dvpr (Addgene plasmid #8455) package plasmid using PolyFect transfection reagent (QIAGEN).

    Knockdown:

    Article Title: Human PARPs modify RNA nucleobases in vitro and in cells
    Article Snippet: .. To make inducible TARG1 knock-down cells, TARG1 shRNA oligos were annealed and cloned into AgeI-EcoRI site of Tet-plko-Puro plasmid (Addgene 21915). ..

    shRNA:

    Article Title: Human PARPs modify RNA nucleobases in vitro and in cells
    Article Snippet: .. To make inducible TARG1 knock-down cells, TARG1 shRNA oligos were annealed and cloned into AgeI-EcoRI site of Tet-plko-Puro plasmid (Addgene 21915). ..

    Article Title: Viral integration drives multifocal HCC during the occult HBV infection
    Article Snippet: .. 8. shRNA oligos The EXT1 shRNA oligonucleotides were annealed and inserted into the AgeI / EcoRI site of the small hairpin RNA (shRNA) expression vector Tet-pLKO-puro (Addgene plasmid 21915). .. Scramble shRNA was used as a negative control. shRNA oligo sequences from Sigma as follows: Sequence 1: CCGGCAATTGTGAGGACATTCTCATCTCGAGATGAGAATGTCCTCACAATTGTTTTTG; Sequence 2: CCGGCCCAACTTTGATGTTTCTATTCTCGAGAATAGAAACATCAAAGTTGGGTTTTTG; Sequence 3: CCGGCCTTCGTTCCTTGGGATCAATCTCGAGATTGATCCCAAGGAACGAAGGTTTTTG 9.

    Expressing:

    Article Title: Viral integration drives multifocal HCC during the occult HBV infection
    Article Snippet: .. 8. shRNA oligos The EXT1 shRNA oligonucleotides were annealed and inserted into the AgeI / EcoRI site of the small hairpin RNA (shRNA) expression vector Tet-pLKO-puro (Addgene plasmid 21915). .. Scramble shRNA was used as a negative control. shRNA oligo sequences from Sigma as follows: Sequence 1: CCGGCAATTGTGAGGACATTCTCATCTCGAGATGAGAATGTCCTCACAATTGTTTTTG; Sequence 2: CCGGCCCAACTTTGATGTTTCTATTCTCGAGAATAGAAACATCAAAGTTGGGTTTTTG; Sequence 3: CCGGCCTTCGTTCCTTGGGATCAATCTCGAGATTGATCCCAAGGAACGAAGGTTTTTG 9.

    Article Title: Attenuated CSF‐1R signalling drives cerebrovascular pathology
    Article Snippet: DNA from the above amplification was purified using a QIAquick PCR purification kit (Qiagen) and subjected to direct sequencing using the forward primer (above). .. For in vitro work, Native, and ΔA781_N783 CSF‐1R cDNA sequences were synthesised using GeneArt (Thermo Fisher Scientific) and cloned into the AgeI/EcoRI site of the pcDNA3‐EGFP expression plasmid (Addgene). .. The P824R expression construct was generated from the native CSF‐1R expression plasmid using the Q5® Site‐Directed Mutagenesis Kit (New England Biolabs) and the following primers: forward 5′‐TGGATGGCCCGAGAGAGCATCTTTG‐3′ and reverse 5′‐CTTCACAGGCAGGCGGGC‐3′.

    In Vitro:

    Article Title: Attenuated CSF‐1R signalling drives cerebrovascular pathology
    Article Snippet: DNA from the above amplification was purified using a QIAquick PCR purification kit (Qiagen) and subjected to direct sequencing using the forward primer (above). .. For in vitro work, Native, and ΔA781_N783 CSF‐1R cDNA sequences were synthesised using GeneArt (Thermo Fisher Scientific) and cloned into the AgeI/EcoRI site of the pcDNA3‐EGFP expression plasmid (Addgene). .. The P824R expression construct was generated from the native CSF‐1R expression plasmid using the Q5® Site‐Directed Mutagenesis Kit (New England Biolabs) and the following primers: forward 5′‐TGGATGGCCCGAGAGAGCATCTTTG‐3′ and reverse 5′‐CTTCACAGGCAGGCGGGC‐3′.

    Clinical Proteomics:

    Article Title: Attenuated CSF‐1R signalling drives cerebrovascular pathology
    Article Snippet: DNA from the above amplification was purified using a QIAquick PCR purification kit (Qiagen) and subjected to direct sequencing using the forward primer (above). .. For in vitro work, Native, and ΔA781_N783 CSF‐1R cDNA sequences were synthesised using GeneArt (Thermo Fisher Scientific) and cloned into the AgeI/EcoRI site of the pcDNA3‐EGFP expression plasmid (Addgene). .. The P824R expression construct was generated from the native CSF‐1R expression plasmid using the Q5® Site‐Directed Mutagenesis Kit (New England Biolabs) and the following primers: forward 5′‐TGGATGGCCCGAGAGAGCATCTTTG‐3′ and reverse 5′‐CTTCACAGGCAGGCGGGC‐3′.



    Similar Products

    99
    TaKaRa agei ecori restriction sites
    Agei Ecori Restriction Sites, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agei+ecori+site/EcoR+I/pm42014675-126-13-11
    Average 99 stars, based on 1 article reviews
    agei ecori restriction sites - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs ecori agei cloning sites
    Ecori Agei Cloning Sites, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agei+ecori+site/EcoRI/bio_rxiv__2025__10__09__681391-361-31-38
    Average 99 stars, based on 1 article reviews
    ecori agei cloning sites - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    96
    Addgene inc agei ecori site
    Agei Ecori Site, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agei+ecori+site/Tet-pLKO-puro+(Plasmid+%2321915)/bio_rxiv__64898__2026__03__31__715305-202-14-19
    Average 96 stars, based on 1 article reviews
    agei ecori site - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc ecori agei site
    Ecori Agei Site, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agei+ecori+site/Tet-pLKO-puro+(Plasmid+%2321915)/pm40318167-201-8-14
    Average 96 stars, based on 1 article reviews
    ecori agei site - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc agei ecori sites
    Agei Ecori Sites, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agei+ecori+site/pLKO%2E1+-+TRC+cloning+vector+(Plasmid+%2310878)/pmc10954759-316-17-22
    Average 96 stars, based on 1 article reviews
    agei ecori sites - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc ecori agei restriction sites
    Ecori Agei Restriction Sites, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/agei+ecori+site/pLKO%2E1+-+TRC+control+(Plasmid+%2310879)/pmc10963270-306-15-19
    Average 96 stars, based on 1 article reviews
    ecori agei restriction sites - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results